WormBase Tree Display for Variation: WBVar00250331

WBVar00250331 Name: Public_name: tm1333
    Other_name: T26C11.6.1:c.1168_1170-105delinsTGA
    HGVSg: CHROMOSOME_X:g.1850474_1851078delinsTCA
  Sequence_details: SMap: S_parent: Sequence: T26C11
    Flanking_sequences: aacatattttgctcaattctttaaaatttc ttttttacgctttgctggagttggctcatc
    Mapping_target: T26C11
    Source_location: 7 CHROMOSOME_X 1850473 1851079 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TCA
      Deletion
    PCR_product: tm1333_external
      tm1333_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1333
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000444
    Transcript: T26C11.6.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T26C11.6.1:c.1168_1170-105delinsTGA
        cDNA_position: 1168-?
        CDS_position: 1168-?
        Protein_position: 390-?
        Intron_number: 5/7
        Exon_number: 5/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. E. Lundquist to the National Bioresource Project of Japan: embryonic/larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
          Comment to the National Bioresource Project of Japan from Dr. E. Lundquist: embryonic/larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000054 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. E. Lundquist to the National Bioresource Project of Japan: embryonic/larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
          Comment to the National Bioresource Project of Japan from Dr. E. Lundquist: embryonic/larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 14994/14995-TCA-15599/15600 (605 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele