WormBase Tree Display for Variation: WBVar00250331
expand all nodes | collapse all nodes | view schema
WBVar00250331 | Name | Public_name | tm1333 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T26C11.6.1:c.1168_1170-105delinsTGA | |||||||
HGVSg | CHROMOSOME_X:g.1850474_1851078delinsTCA | |||||||
Sequence_details | SMap | S_parent | Sequence | T26C11 | ||||
Flanking_sequences | aacatattttgctcaattctttaaaatttc | ttttttacgctttgctggagttggctcatc | ||||||
Mapping_target | T26C11 | |||||||
Source_location | 7 | CHROMOSOME_X | 1850473 | 1851079 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TCA | ||||||
Deletion | ||||||||
PCR_product | tm1333_external | |||||||
tm1333_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1333 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000444 | ||||||
Transcript | T26C11.6.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T26C11.6.1:c.1168_1170-105delinsTGA | |||||||
cDNA_position | 1168-? | |||||||
CDS_position | 1168-? | |||||||
Protein_position | 390-? | |||||||
Intron_number | 5/7 | |||||||
Exon_number | 5/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000050 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. E. Lundquist to the National Bioresource Project of Japan: embryonic/larval lethal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Comment to the National Bioresource Project of Japan from Dr. E. Lundquist: embryonic/larval lethal. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000054 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. E. Lundquist to the National Bioresource Project of Japan: embryonic/larval lethal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Comment to the National Bioresource Project of Japan from Dr. E. Lundquist: embryonic/larval lethal. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 14994/14995-TCA-15599/15600 (605 bp deletion + 3 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |