WormBase Tree Display for Variation: WBVar00250332
expand all nodes | collapse all nodes | view schema
WBVar00250332 | Name | Public_name | tm1335 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y106G6H.12b.1:c.32_443+395delinsGGGAGATCCCCTTT | |||||||
Y106G6H.12a.1:c.497_908+395delinsGGGAGATCCCCTTT | ||||||||
HGVSg | CHROMOSOME_I:g.10469070_10469930delinsAAAGGGGATCTCCC | |||||||
Sequence_details | SMap | S_parent | Sequence | Y106G6H | ||||
Flanking_sequences | gaaaaggggagcaacgaaaaggggatctgg | aaggagtcagcgtatgttgaagatttacca | ||||||
Mapping_target | Y106G6H | |||||||
Source_location | 7 | CHROMOSOME_I | 10469067 | 10469931 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CAAAAGGGGATCTCCC | ||||||
Deletion | ||||||||
PCR_product | tm1335_external | |||||||
tm1335_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1335 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001112 | ||||||
Transcript | Y106G6H.12a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y106G6H.12a.1:c.497_908+395delinsGGGAGATCCCCTTT | |||||||
cDNA_position | 497-? | |||||||
CDS_position | 497-? | |||||||
Protein_position | 166-? | |||||||
Intron_number | 4-5/11 | |||||||
Exon_number | 4-5/12 | |||||||
Y106G6H.12b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y106G6H.12b.1:c.32_443+395delinsGGGAGATCCCCTTT | |||||||
cDNA_position | 32-? | |||||||
CDS_position | 32-? | |||||||
Protein_position | 11-? | |||||||
Intron_number | 1-2/7 | |||||||
Exon_number | 1-2/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to National Bioresource Project of Japan: normal growth rate. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000032 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to National Bioresource Project of Japan: healthy. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000315 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to National Bioresource Project of Japan: normal response to touch and tap stimuli. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Inoue to National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Sawa to National Bioresource Project of Japan: non Psa. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 41910/41911-CAAAAGGGGATCTCCC-42773/42774 (863 bp deletion + 16 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |