WormBase Tree Display for Variation: WBVar00250345

WBVar00250345 Name: Public_name: tm1350
    HGVSg: CHROMOSOME_II:g.7055268_7055586del
  Sequence_details: SMap: S_parent: Sequence: ZK1127
    Flanking_sequences: ttatgttacctttttttaaaacttatacgc cgaaatatttctaagcggtcagtgaactac
    Mapping_target: ZK1127
    Source_location: 7 CHROMOSOME_II 7055267 7055587 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1350_external
      tm1350_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1350
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022850
    Transcript: ZK1127.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-255
        CDS_position: ?-245
        Protein_position: ?-82
        Intron_number: 2/5
        Exon_number: 1-3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000057 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: early larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 21198/21199-21517/21518 (319 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele