WormBase Tree Display for Variation: WBVar00250382

WBVar00250382 Name: Public_name: tm1388
    Other_name: ZC328.1.1:c.413_*50del
    HGVSg: CHROMOSOME_I:g.6405161_6405658del
  Sequence_details: SMap: S_parent: Sequence: ZC328
    Flanking_sequences: ttcaattcacaagacaagtctttggaatat ataatttctctaccatcaaagttttactga
    Mapping_target: ZC328
    Source_location: 7 CHROMOSOME_I 6405160 6405659 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1388_external
      tm1388_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1388
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022591
    Transcript: ZC328.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZC328.1.1:c.413_*50del
        cDNA_position: 419-665
        CDS_position: 413-?
        Protein_position: 138-?
        Intron_number: 4/5
        Exon_number: 4-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 18803/18804-19301/19302 (498 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele