WormBase Tree Display for Variation: WBVar00250409

WBVar00250409 Name: Public_name: tm1416
    Other_name: F13E6.4.1:c.445_713-44del
    HGVSg: CHROMOSOME_X:g.10692837_10693362del
  Sequence_details: SMap: S_parent: Sequence: F13E6
    Flanking_sequences: gcattaccaatgactattggctactctcca tacaatctgttcacattaaatattaattta
    Mapping_target: F13E6
    Source_location: 7 CHROMOSOME_X 10692836 10693363 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1416_external
      tm1416_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1416
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008748
    Transcript: F13E6.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F13E6.4.1:c.445_713-44del
        cDNA_position: 450-?
        CDS_position: 445-?
        Protein_position: 149-?
        Intron_number: 6-7/11
        Exon_number: 6-7/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000061 Paper_evidence: WBPaper00041976
        Curator_confirmed: WBPerson3250
      WBPhenotype:0000141 Paper_evidence: WBPaper00041976
        Curator_confirmed: WBPerson3250
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. J. Lee: protruding vulva. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: LJ
      WBPhenotype:0001274 Paper_evidence: WBPaper00041976
        Curator_confirmed: WBPerson3250
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000711 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: not sensitive to IR. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0000775 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: normal meiosis. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0001175 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: non-Him. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0001257 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: Not required for FCD-2 focus formation after CDDP. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0001377 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: Not required for BRC-1 focus formation after IR. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0001379 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: not sensitive to CDDP. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
  Reference: WBPaper00041976
  Remark: 22405/22406-22931/22932 (526 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele