WormBase Tree Display for Variation: WBVar00250416
expand all nodes | collapse all nodes | view schema
WBVar00250416 | Name | Public_name | tm1423 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F57B10.1.2:c.587-369_918+105del | |||||||
F57B10.1.1:c.587-369_918+105del | ||||||||
HGVSg | CHROMOSOME_I:g.6581666_6582471del | |||||||
Sequence_details | SMap | S_parent | Sequence | F48A9 | ||||
Flanking_sequences | gaataacaatttctaagcctaaaaccatta | ggacaaatttgagaaaactagttgatagtt | ||||||
Mapping_target | F48A9 | |||||||
Source_location | 7 | CHROMOSOME_I | 6581665 | 6582472 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1423_external | |||||||
tm1423_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040745 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1423 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002783 | ||||||
WBGene00197712 | ||||||||
Transcript | F48A9.4 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F57B10.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F57B10.1.1:c.587-369_918+105del | |||||||
Intron_number | 5-6/9 | |||||||
Exon_number | 6/10 | |||||||
F57B10.1.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F57B10.1.2:c.587-369_918+105del | |||||||
Intron_number | 4-5/8 | |||||||
Exon_number | 5/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 33281/33282-34087/34088 (806 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target F57B10 updated based on the VEP analysis pipeline to F48A9. | ||||||||
Method | NBP_knockout_allele |