WormBase Tree Display for Variation: WBVar00250421

WBVar00250421 Name: Public_name: tm1428
    HGVSg: CHROMOSOME_I:g.8615265_8615715del
  Sequence_details: SMap: S_parent: Sequence: F43G9
    Flanking_sequences: tggacaaactgtttctaggccatctgtaca ctcctgcagattggtaccaccttttataaa
    Mapping_target: F43G9
    Source_location: 7 CHROMOSOME_I 8615264 8615716 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1428_external
      tm1428_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1428
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009668
    Transcript: F43G9.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-281
        CDS_position: ?-276
        Protein_position: ?-92
        Intron_number: 2/5
        Exon_number: 1-3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 10105/10106-10556/10557 (451 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele