WormBase Tree Display for Variation: WBVar00250429

WBVar00250429 Name: Public_name: tm1436
    Other_name: W10D5.2.2:c.106+157_307-25del
      W10D5.2.1:c.106+157_307-25del
    HGVSg: CHROMOSOME_I:g.9109647_9110345del
  Sequence_details: SMap: S_parent: Sequence: W10D5
    Flanking_sequences: atcggcctgaaatattttgataaatagata tgaatgaatcataactctcaagaataaaca
    Mapping_target: W10D5
    Source_location: 7 CHROMOSOME_I 9109646 9110346 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1436_external
      tm1436_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1436
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012376
    Transcript: W10D5.2.2 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W10D5.2.2:c.106+157_307-25del
        Intron_number: 2-3/5
        Exon_number: 3/6
      W10D5.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W10D5.2.1:c.106+157_307-25del
        Intron_number: 1-2/4
        Exon_number: 2/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Paper_evidence: WBPaper00046863
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
          WBPerson2987
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
          "The nduf-7(et19) is likely a partial loss-of-function allele because the more severe nduf-7(tm1436) allele, which lacks the second exon and part of the third exon (Figure 3A), is lethal (Supporting Information, Figure S1)." Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00046863
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. S. van den Heuvel to the National Bioresource Project of Japan : Ste Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Reference: WBPaper00046863
  Remark: 20580/20581-21279/21280 (699 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele