WormBase Tree Display for Variation: WBVar00250432

WBVar00250432 Name: Public_name: tm1439
    HGVSg: CHROMOSOME_I:g.8591547_8592113del
  Sequence_details: SMap: S_parent: Sequence: R05D11
    Flanking_sequences: gcgatcactgtgattgactctcagcctctg ggcagaaagagatctatgaggagaatcaga
    Mapping_target: R05D11
    Source_location: 7 CHROMOSOME_I 8591546 8592114 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1439_external
      tm1439_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1439
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004305
      WBGene00011033
    Transcript: R05D11.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 249-?
        CDS_position: 247-?
        Protein_position: 83-?
        Intron_number: 4/5
        Exon_number: 4-6/6
      R05D11.5.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-22
        CDS_position: ?-22
        Protein_position: ?-8
        Exon_number: 1/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 12603/12604-13170/13171 (567 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele