WormBase Tree Display for Variation: WBVar00250440

WBVar00250440 Name: Public_name: tm1447
    HGVSg: CHROMOSOME_IV:g.16946841_16949103del
  Sequence_details: SMap: S_parent: Sequence: Y116A8C
    Flanking_sequences: atttttagcaatttttcatgattttttcac taaaaaacccatattttccacctgaaaacg
    Mapping_target: Y116A8C
    Source_location: 7 CHROMOSOME_IV 16946840 16949104 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1447_external
      tm1447_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1447
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000184
    Transcript: Y116A8C.12.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-6/7
        Exon_number: 1-6/8
    Interactor: WBInteraction000052352
      WBInteraction000500588
      WBInteraction000500589
      WBInteraction000500590
      WBInteraction000518515
      WBInteraction000521264
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to National Bioresource Project of Japan from Dr. M. Han. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan; from Dr. Y. Jin: could not maintain as homozygote. Originally classified as homozygous viable by the NBP. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CZ
      WBPhenotype:0000216 Paper_evidence: WBPaper00038432
        Curator_confirmed: WBPerson712
        Remark: Animals displayed a weak extra A/PVM phenotype. Paper_evidence: WBPaper00038432
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: ayIs9[Pegl-17::gfp] Paper_evidence: WBPaper00038432
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000102 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: HSN vulval presynaptic vesicle clusters appear normal (unc-86::SNB-1::YFP). Comment to National Bioresource Project of Japan from Dr. K. Shen. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: TV
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to National Bioresource Project of Japan from Dr. M. Han; Dr. J. Lee: normal touch response. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
              LJ
      WBPhenotype:0000436 Paper_evidence: WBPaper00040857
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Rongo to the National Bioresource Project of Japan: normal GLR-1::GFP localization and expression. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OR
          Mutation did not cause SNB-1::VENUS localization defects. Paper_evidence: WBPaper00040857
            Curator_confirmed: WBPerson712
      WBPhenotype:0000623 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Y. Jin to the National Bioresource Project of Japan: no specific neuronal phenotype is found. Comment from Dr. J-L. Bessereau to the National Bioresource Project of Japan: no specific neuronal phenotype. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CZ
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: No obvious defects. Comment to National Bioresource Project of Japan from Dr. K. Shen. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000699 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to National Bioresource Project of Japan from Dr. M. Han. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
      WBPhenotype:0001408 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Rongo to the National Bioresource Project of Japan: normal GLR-1::GFP localization and expression. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OR
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Blacque to the National Bioresource Project of Japan: dye-filling normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OEB
  Reference: WBPaper00038432
    WBPaper00040857
  Remark: 46750/46751-49013/49014 (2263 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele