WormBase Tree Display for Variation: WBVar00250461

WBVar00250461 Name: Public_name: tm1468
    Other_name: F25H5.5a.1:c.336_779+17del
    HGVSg: CHROMOSOME_I:g.9162334_9162882del
  Sequence_details: SMap: S_parent: Sequence: F25H5
    Flanking_sequences: tatgttacacaaaaaccgcagaaaataaat gccaatttcggaattttttcagcattaaac
    Mapping_target: F25H5
    Source_location: 7 CHROMOSOME_I 9162333 9162883 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1468_external
      tm1468_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1468
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009127
    Transcript: F25H5.5a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F25H5.5a.1:c.336_779+17del
        cDNA_position: 341-?
        CDS_position: 336-?
        Protein_position: 112-?
        Intron_number: 3-5/9
        Exon_number: 3-5/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. S. van den Heuvel: Ste Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. S. van den Heuvel: Pvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000875 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: 1) Dr. A. Gartner: no defect in the S-phase checkpoint. 2) Dr. S. Boulton: not required for the S-phase checkpoint. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 7455/7456-8004/8005 (549 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele