WormBase Tree Display for Variation: WBVar00250463
expand all nodes | collapse all nodes | view schema
WBVar00250463 | Name | Public_name | tm1471 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F41G4.3d.2:c.-22+61_61-8del | |||||||
F41G4.3b.1:c.34-90_115-8del | ||||||||
F41G4.3c.1:c.274-90_355-8del | ||||||||
F41G4.3e.1:c.40-90_121-8del | ||||||||
F41G4.3a.1:c.118-90_199-8del | ||||||||
F41G4.3d.1:c.-21-90_61-8del | ||||||||
HGVSg | CHROMOSOME_X:g.16817956_16818461del | |||||||
Sequence_details | SMap | S_parent | Sequence | F41G4 | ||||
Flanking_sequences | tgggagataagcggcggtggttcctgaaat | ggaacctgaaacgtgttggttaacctggaa | ||||||
Mapping_target | F41G4 | |||||||
Source_location | 7 | CHROMOSOME_X | 16817955 | 16818462 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1471_external | |||||||
tm1471_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1471 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006067 | ||||||
Transcript | F41G4.3c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F41G4.3c.1:c.274-90_355-8del | |||||||
Intron_number | 2-3/8 | |||||||
Exon_number | 3/9 | |||||||
F41G4.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F41G4.3a.1:c.118-90_199-8del | |||||||
Intron_number | 3-4/9 | |||||||
Exon_number | 4/10 | |||||||
F41G4.3d.3 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-2/8 | |||||||
F41G4.3e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F41G4.3e.1:c.40-90_121-8del | |||||||
Intron_number | 1-2/6 | |||||||
Exon_number | 2/7 | |||||||
F41G4.3d.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F41G4.3d.2:c.-22+61_61-8del | |||||||
Intron_number | 1-3/8 | |||||||
Exon_number | 2-3/9 | |||||||
F41G4.3d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F41G4.3d.1:c.-21-90_61-8del | |||||||
Intron_number | 1-3/8 | |||||||
Exon_number | 2-3/9 | |||||||
F41G4.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F41G4.3b.1:c.34-90_115-8del | |||||||
Intron_number | 2-3/8 | |||||||
Exon_number | 3/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Hunter to the National Bioresource Project of Japan: normal growth | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000315 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. M. Chalfie: non-Mec. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000518 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Hunter to the National Bioresource Project of Japan: normal developement at 20C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000625 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by VAMP::YFP localization to presynaptic sites in HSNL. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | TV | |||||||
Remark | 12808/12809-13314/13315 (506 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |