WormBase Tree Display for Variation: WBVar00250465
expand all nodes | collapse all nodes | view schema
WBVar00250465 | Name | Public_name | tm1473 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T01B10.4b.1:c.494_574-57del | |||||||
T01B10.4a.1:c.494_574-57del | ||||||||
HGVSg | CHROMOSOME_X:g.8475152_8475560del | |||||||
Sequence_details | SMap | S_parent | Sequence | T01B10 | ||||
Flanking_sequences | atgtcacaaactatcacatttcaaatattc | tgttcttcatttccgattcgtctctgagaa | ||||||
Mapping_target | T01B10 | |||||||
Source_location | 7 | CHROMOSOME_X | 8475151 | 8475561 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1473_external | |||||||
tm1473_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1473 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003613 | ||||||
Transcript | T01B10.4b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T01B10.4b.1:c.494_574-57del | |||||||
cDNA_position | 496-? | |||||||
CDS_position | 494-? | |||||||
Protein_position | 165-? | |||||||
Intron_number | 4/7 | |||||||
Exon_number | 4/8 | |||||||
T01B10.4a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01B10.4a.1:c.494_574-57del | |||||||
cDNA_position | 494-? | |||||||
CDS_position | 494-? | |||||||
Protein_position | 165-? | |||||||
Intron_number | 3/6 | |||||||
Exon_number | 3/7 | |||||||
Interactor | WBInteraction000503386 | |||||||
WBInteraction000503387 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000039 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. S.S. Lee: no lifespan phenotype. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IU | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000518 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. S.S. Lee: no developmental phenotype. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IU | |||||||
WBPhenotype:0000730 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. X. Wang: normal apoptosis. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | XW | |||||||
Remark | 6666/6667-7075/7076 (409 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |