WormBase Tree Display for Variation: WBVar00250470
expand all nodes | collapse all nodes | view schema
WBVar00250470 | Name | Public_name | tm1478 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F33D11.4a.1:c.459+217_460-354del | |||||||
F33D11.4b.1:c.132+217_133-354del | ||||||||
HGVSg | CHROMOSOME_I:g.5841104_5841449del | |||||||
Sequence_details | SMap | S_parent | Sequence | F33D11 | ||||
Flanking_sequences | aattatttgaactttatggggatttaaact | cggctgtcggctgtcggctgattggaaaaa | ||||||
Mapping_target | F33D11 | |||||||
Source_location | 7 | CHROMOSOME_I | 5841103 | 5841450 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1478_external | |||||||
tm1478_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1478 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000436 | ||||||
Transcript | F33D11.4b.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F33D11.4b.1:c.132+217_133-354del | |||||||
Intron_number | 1/1 | |||||||
F33D11.4a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F33D11.4a.1:c.459+217_460-354del | |||||||
Intron_number | 4/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. D.M. Miller to the National Bioresource Project of Japan: no locomotory perturbations. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 7887/7888-8233/8234 (346 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |