WormBase Tree Display for Variation: WBVar00250475

WBVar00250475 Name: Public_name: tm1483
    Other_name: F17C11.8.1:c.97-40_506delinsTAATCGTTCAAAAATCGTTAATCGTTCAAAAAGTTCAAAAATCAAATC
    HGVSg: CHROMOSOME_V:g.10959848_10960462delinsGATTTGATTTTTGAACTTTTTGAACGATTAACGATTTTTGAACGATTA
  Sequence_details: SMap: S_parent: Sequence: F17C11
    Flanking_sequences: atatcgtcgaatgcctgtgtgattgtttcg actgatttttgttaataattaacgaaattg
    Mapping_target: F17C11
    Source_location: 7 CHROMOSOME_V 10959847 10960463 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GATTTGATTTTTGAACTTTTTGAACGATTAACGATTTTTGAACGATTA
      Deletion
    PCR_product: tm1483_external
      tm1483_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1483
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008919
      WBGene00172481
    Transcript: F17C11.19
      F17C11.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F17C11.8.1:c.97-40_506delinsTAATCGTTCAAAAATCGTTAATCGTTCAAAAAGTTCAAAAATCAAATC
        cDNA_position: ?-515
        CDS_position: ?-506
        Protein_position: ?-169
        Intron_number: 2-4/6
        Exon_number: 3-5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000058 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Zhen to the National Bioresource Project of Japan: L3 or L4 lethal in homozygous animals. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000604 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Zhen to the National Bioresource Project of Japan: No obvious defects in nervous system. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000623 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Zhen to the National Bioresource Project of Japan: No obvious defects in nervous system. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 25565/25566-GATTTGATTTTTGAACTTTTTGAACGATTAACGATTTTTGAACGATTA-26180/26181 (615 bp deletion + 48 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele