WormBase Tree Display for Variation: WBVar00250477
expand all nodes | collapse all nodes | view schema
WBVar00250477 | Name | Public_name | tm1485 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C18C4.10a.1:c.39-112_588del | |||||||
C18C4.10b.2:c.-25-112_525del | ||||||||
HGVSg | CHROMOSOME_V:g.5578877_5579641del | |||||||
Sequence_details | SMap | S_parent | Sequence | C18C4 | ||||
Flanking_sequences | ttggttgaattgactagcattcatatcttc | attaggtcgttcaataagttttgcgatagt | ||||||
Mapping_target | C18C4 | |||||||
Source_location | 7 | CHROMOSOME_V | 5578876 | 5579642 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1485_external | |||||||
tm1485_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1485 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002215 | ||||||
Transcript | C18C4.10b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C18C4.10b.2:c.-25-112_525del | |||||||
cDNA_position | ?-659 | |||||||
CDS_position | ?-525 | |||||||
Protein_position | ?-175 | |||||||
Intron_number | 1-4/7 | |||||||
Exon_number | 2-5/8 | |||||||
C18C4.10a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C18C4.10a.1:c.39-112_588del | |||||||
cDNA_position | ?-650 | |||||||
CDS_position | ?-588 | |||||||
Protein_position | ?-196 | |||||||
Intron_number | 2-4/7 | |||||||
Exon_number | 3-5/8 | |||||||
C18C4.10b.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-533 | |||||||
CDS_position | ?-525 | |||||||
Protein_position | ?-175 | |||||||
Intron_number | 1-3/6 | |||||||
Exon_number | 1-4/7 | |||||||
C18C4.10b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-550 | |||||||
CDS_position | ?-525 | |||||||
Protein_position | ?-175 | |||||||
Intron_number | 2-3/6 | |||||||
Exon_number | 1-4/7 | |||||||
C18C4.10c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-556 | |||||||
CDS_position | ?-525 | |||||||
Protein_position | ?-175 | |||||||
Intron_number | 2-3/6 | |||||||
Exon_number | 1-4/7 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Barr: lost. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0000102 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: unable to examine HSN synaptic phenotypes. Rare escapers show normal HSN vulaval presynaptic vesicle clusters (unc-86::SNB-1::YFP). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: dyf+ in all sensory neurons. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 40118/40119-40883/40884 (765 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |