WormBase Tree Display for Variation: WBVar00250481
expand all nodes | collapse all nodes | view schema
WBVar00250481 | Name | Public_name | tm1489 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.10754897_10755568del | |||||||
Sequence_details | SMap | S_parent | Sequence | K01G5 | ||||
Flanking_sequences | tgaaaataggagaataatcgaacaaaaatc | aaaaatatggaataaagattcgaacaatat | ||||||
Mapping_target | K01G5 | |||||||
Source_location | 7 | CHROMOSOME_III | 10754896 | 10755569 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1489_external | |||||||
tm1489_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027510 | |||||||
WBStrain00027526 | ||||||||
WBStrain00030669 | ||||||||
WBStrain00030670 | ||||||||
WBStrain00051702 | ||||||||
WBStrain00055798 | ||||||||
Laboratory | FX | |||||||
AS | ||||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1489 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001996 | ||||||
WBGene00305495 | ||||||||
Transcript | K01G5.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 1-3/8 | |||||||
K01G5.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/5 | |||||||
Exon_number | 1-3/6 | |||||||
K01G5.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 1-3/8 | |||||||
K01G5.13 | ||||||||
Interactor (38) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show larval arrest at 26 deg C. | Paper_evidence | WBPaper00038168 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00038168 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00040560 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | hpl-2(tm1489) animals raised at 20C and shifted to 25C at the L4 stage. | Paper_evidence | WBPaper00040560 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000105 | Paper_evidence | WBPaper00038257 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 1% of hpl-2 worms had no oocytes and 2% displayed failures in gonad elongation, 32% showed defects in oocyte maturation or fertilization (n = 88). | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00040560 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | hpl-2 regulates sms-3 mRNA levels. sms-3 (involved in phospholipid metabolism) is downregulated in hpl-2 mutants. | Paper_evidence | WBPaper00040560 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00038257 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit reduced brood size at 20 and 24.5 degrees C. The phenotype is stronger at the higher temperature. | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 24.5 | Paper_evidence | WBPaper00038257 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000357 | Paper_evidence | WBPaper00038257 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 1% of hpl-2 worms had no oocytes and 2% displayed failures in gonad elongation, 32% showed defects in oocyte maturation or fertilization (n = 88). | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00038257 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: 1) Dr. R.H. Horvitz : not completely penetrant multivulva. 2) Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MT | |||||||
MH | ||||||||
hpl-2 mutation caused some sterility of worms (13%) that was enhanced at higher temperature (25% at 24.5 degrees C). | Paper_evidence | WBPaper00038257 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038257 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
24.5 | Paper_evidence | WBPaper00038257 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00038257 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: 1) Dr. R.H. Horvitz : not completely penetrant multivulva. 2) Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MT | |||||||
MH | ||||||||
hpl-2 mutant worms did not show a phenotype at 20 degrees C, but displayed low frequency of Muv phenotype at elevated temperature (24.5 degrees C). | Paper_evidence | WBPaper00038257 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038257 | |||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 24.5 | Paper_evidence | WBPaper00038257 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00046104 | ||||||
Curator_confirmed | WBPerson10085 | |||||||
Remark | Maternal-effect sterile at 25 degrees Celsius | Paper_evidence | WBPaper00046104 | |||||
Curator_confirmed | WBPerson10085 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00046104 | ||||
Curator_confirmed | WBPerson10085 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00038168 | |||||||
WBPaper00038257 | ||||||||
WBPaper00040560 | ||||||||
WBPaper00046104 | ||||||||
WBPaper00065754 | ||||||||
Remark | 14347/14348-15019/15020 (672 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |