WormBase Tree Display for Variation: WBVar00250489

WBVar00250489 Name: Public_name: tm1497
    HGVSg: CHROMOSOME_X:g.10285038_10285943del
  Sequence_details: SMap: S_parent: Sequence: F41E7
    Flanking_sequences: atctatggctatagccgtaagtgtccacgt caaatttaaagctcccaaaagaatataaaa
    Mapping_target: F41E7
    Source_location: 7 CHROMOSOME_X 10285037 10285944 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1497_external
      tm1497_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1497
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009619
    Transcript: F41E7.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-411
        CDS_position: ?-372
        Protein_position: ?-124
        Intron_number: 2-5/12
        Exon_number: 1-6/13
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment from Dr. C. Bargmann to the NBP: viable Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000478 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no defects in thermotaxis. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: normal locomotion Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: fertile Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00064927
    WBPaper00065340
  Remark: 8809/8810-9715/9716 (906 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele