WormBase Tree Display for Variation: WBVar00250494

WBVar00250494 Name: Public_name: tm1502
    HGVSg: CHROMOSOME_I:g.8763004_8763608del
  Sequence_details: SMap: S_parent: Sequence: DY3
    Flanking_sequences: tcctctcttctcttacatctctctttgtct gataagtgttggaatatagattatttgtat
    Mapping_target: DY3
    Source_location: 7 CHROMOSOME_I 8763003 8763609 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1502_external
      tm1502_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00026345
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1502
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003052
    Transcript: DY3.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-4/7
        Exon_number: 1-4/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Paper_evidence: WBPaper00040258
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. J. Liu & Dr. Y. Gruenbaum: Proc Natl Acad Sci U S A102, 16690-16695 (2005). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Loss of LMN-1 is lethal.Nonetheless, 50% of homozygous lmn-1-deficient worms (i.e., offspring of heterozygous mothers) are able to develop into sterile adults, as a result of the presence of maternal RNA and the relatively slow rate of lamin turnover. Paper_evidence: WBPaper00040258
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00040258
              Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00040258
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. J. Liu & Dr. Y. Gruenbaum: Proc Natl Acad Sci U S A102, 16690-16695 (2005). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Loss of LMN-1 is lethal.Nonetheless, 50% of homozygous lmn-1-deficient worms (i.e., offspring of heterozygous mothers) are able to develop into sterile adults, as a result of the presence of maternal RNA and the relatively slow rate of lamin turnover. Paper_evidence: WBPaper00040258
            Curator_confirmed: WBPerson712
      WBPhenotype:0001236 Paper_evidence: WBPaper00040258
        Curator_confirmed: WBPerson712
        Remark: gwIs[myo-3::rfp]; baf-1::gfp-lacI] is derepressed. In over 60% of larvae and adult worms that were homozygous for the lmn-1(tm1502) deletion, a small number of cells had extremely bright, homogenously fluorescent nuclei, as a result of massive GFP-lacI expression. Paper_evidence: WBPaper00040258
            Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:3911
      DOID:11726
    Models_disease_in_annotation: WBDOannot00000298
      WBDOannot00000531
      WBDOannot00000541
  Reference: WBPaper00040258
  Remark: 4675/4676-5280/5281 (605 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele