WormBase Tree Display for Variation: WBVar00250513

WBVar00250513 Name: Public_name: tm1523
    Other_name: T20D3.7b.1:c.61_227-170del
      T20D3.7d.1:c.61_227-164del
      T20D3.7a.1:c.217_383-170del
      T20D3.7c.1:c.217_383-164del
    HGVSg: CHROMOSOME_IV:g.9341173_9341574del
  Sequence_details: SMap: S_parent: Sequence: T20D3
    Flanking_sequences: ttgaaaagaaaaataagtatgaaggttttc ctcatttgagagccgaatttgaatttctgc
    Mapping_target: T20D3
    Source_location: 7 CHROMOSOME_IV 9341172 9341575 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1523_external
      tm1523_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1523
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006931
    Transcript: T20D3.7d.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T20D3.7d.1:c.61_227-164del
        cDNA_position: 61-?
        CDS_position: 61-?
        Protein_position: 21-?
        Intron_number: 1-2/4
        Exon_number: 1-2/5
      T20D3.7c.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T20D3.7c.1:c.217_383-164del
        cDNA_position: 217-?
        CDS_position: 217-?
        Protein_position: 73-?
        Intron_number: 1-2/5
        Exon_number: 1-2/6
      T20D3.7b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T20D3.7b.1:c.61_227-170del
        cDNA_position: 61-?
        CDS_position: 61-?
        Protein_position: 21-?
        Intron_number: 1-2/4
        Exon_number: 1-2/5
      T20D3.7a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T20D3.7a.1:c.217_383-170del
        cDNA_position: 217-?
        CDS_position: 217-?
        Protein_position: 73-?
        Intron_number: 1-2/5
        Exon_number: 1-2/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000469 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H.C. Korswagen to the National Bioresource Project of Japan: QL and QR daughter cells, HSN migration defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000470 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H.C. Korswagen to the National Bioresource Project of Japan: QL and QR daughter cells, HSN migration defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001235 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H.C. Korswagen to the National Bioresource Project of Japan: polarity of V5 division defects, similar to egl-20. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0004890 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
            WBbt:0004876 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000623 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Shaham to the National Bioresource Project of Japan: no obvious defects in glia development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000625 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 14539/14540-14941/14942 (402 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele