WormBase Tree Display for Variation: WBVar00250523

WBVar00250523 Name: Public_name: tm1533
    HGVSg: CHROMOSOME_I:g.9647430_9648215del
  Sequence_details: SMap: S_parent: Sequence: T05F1
    Flanking_sequences: cgggagcccaatggttgaattgtgaatttg aaggcatacctggtagctgctccagtggcg
    Mapping_target: T05F1
    Source_location: 7 CHROMOSOME_I 9647429 9648216 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1533_external
      tm1533_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1533
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011494
      WBGene00000968
    Transcript: T05F1.10.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 6-7/8
        Exon_number: 7-9/9
      T05F1.9.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 966-?
        CDS_position: 905-?
        Protein_position: 302-?
        Exon_number: 6-7/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 27260/27261-28046/28047 (786 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele