WormBase Tree Display for Variation: WBVar00250539

WBVar00250539 Name: Public_name: tm1552
    Other_name: F16F9.5.1:c.568-4_908del
    HGVSg: CHROMOSOME_X:g.8468682_8469129del
  Sequence_details: SMap: S_parent: Sequence: T01B10
    Flanking_sequences: atacctttcttagcttttttgctgcataaa aaaaatatgaatagaggggaaaactctcgg
    Mapping_target: T01B10
    Source_location: 7 CHROMOSOME_X 8468681 8469130 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1552_external
      tm1552_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00022724
      WBStrain00040801
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1552
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003174
    Transcript: F16F9.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F16F9.5.1:c.568-4_908del
        cDNA_position: ?-982
        CDS_position: ?-908
        Protein_position: ?-303
        Intron_number: 5-6/18
        Exon_number: 6-7/19
    Interactor: WBInteraction000504392
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000315 Paper_evidence: WBPaper00049676
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson34063
        Remark: Comment from the National Bioresource Project of Japan: Dr. M. Driscoll: touch insensitive. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
          Fig. 6 The gentle touch response is abnormal in tm1552 worms Paper_evidence: WBPaper00049676
            Curator_confirmed: WBPerson34063
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002026 Paper_evidence: WBPaper00040149
        Curator_confirmed: WBPerson712
        Remark: Animals all showed a reduced response to touch near the ALM cell body compared with touch near the second pharyngeal bulb. Paper_evidence: WBPaper00040149
            Curator_confirmed: WBPerson712
  Reference: WBPaper00040149
    WBPaper00049676
    WBPaper00065804
  Remark: 30081/30082-30529/30530 (448 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F16F9 updated based on the VEP analysis pipeline to T01B10.
  Method: NBP_knockout_allele