WormBase Tree Display for Variation: WBVar00250544

WBVar00250544 Name: Public_name: tm1557
    HGVSg: CHROMOSOME_I:g.10685754_10686287del
  Sequence_details: SMap: S_parent: Sequence: C34B2
    Flanking_sequences: aatttttgttcctgcgcctttaagtttgaa tcctggaacatccttcataatttcctcttc
    Mapping_target: C34B2
    Source_location: 7 CHROMOSOME_I 10685753 10686288 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1557_external
      tm1557_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1557
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016393
    Transcript: C34B2.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 318-?
        CDS_position: 313-?
        Protein_position: 105-?
        Intron_number: 4/5
        Exon_number: 4-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 15036/15037-15570/15571 (534 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele