WormBase Tree Display for Variation: WBVar00250546

WBVar00250546 Name: Public_name: tm1559
    HGVSg: CHROMOSOME_V:g.14424902_14425298delinsGTATA
  Sequence_details: SMap: S_parent: Sequence: C15H11
    Flanking_sequences: ggtttaattaataacgaaattctataatat gtggtttttgcaacgccaccgcacgcattt
    Mapping_target: C15H11
    Source_location: 7 CHROMOSOME_V 14424901 14425299 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GTATA
      Deletion
    PCR_product: tm1559_external
      tm1559_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1559
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007617
    Transcript: C15H11.9.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: HIGH
        Intron_number: 2/4
        Exon_number: 1-2/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 40390/40391-GTATA-40787/40788 (397 bp deletion + 5 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele