WormBase Tree Display for Variation: WBVar00250553

WBVar00250553 Name: Public_name: tm1567
    Other_name: C32F10.1a.1:c.477_514-36delinsT
    HGVSg: CHROMOSOME_I:g.5829926_5830465delinsT
  Sequence_details: SMap: S_parent: Sequence: C32F10
    Flanking_sequences: tgattcattgattgcggcgagcaataattt caaaaaagagcttctaacaaaatctcaaat
    Mapping_target: C32F10
    Source_location: 7 CHROMOSOME_I 5829925 5830466 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm1567_external
      tm1567_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1567
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016331
    Transcript: C32F10.1a.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C32F10.1a.1:c.477_514-36delinsT
        cDNA_position: 486-?
        CDS_position: 477-?
        Protein_position: 159-?
        Intron_number: 3/11
        Exon_number: 3/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
    Mapping_data: In_multi_point: 4926
  Description: Phenotype_not_observed: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT embryonic lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000054 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT larval lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000104 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Comment from to the National Bioresource Project of Japan: Dr. H.C. Korswagen: no ALM/PLM polarity defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000469 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Comment from to the National Bioresource Project of Japan: Dr. H.C. Korswagen: no QL migration defect Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000676 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. H. Arai to the National Bioresource Project of Japan: WT growth rate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 25711/25712-T-26251/26252 (540 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele