WormBase Tree Display for Variation: WBVar00250568

WBVar00250568 Name: Public_name: tm1583
    HGVSg: CHROMOSOME_IV:g.11459749_11461565delinsTTTT
  Sequence_details: SMap: S_parent: Sequence: C10C6
    Flanking_sequences: tacaacggtagggtgtcgttgcggagttcc ttgttttctgcatttggcttctcggatact
    Mapping_target: C10C6
    Source_location: 7 CHROMOSOME_IV 11459748 11461566 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTT
      Deletion
    PCR_product: tm1583_external
      tm1583_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1583
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007006
    Transcript: C10C6.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-435
        CDS_position: ?-427
        Protein_position: ?-143
        Intron_number: 2-4/8
        Exon_number: 1-5/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
    Mapping_data: In_multi_point: 5044
  Description: Phenotype (17)
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00043908
  Remark: 23997/23998-TTTT-25814/25815 (1817 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele