WormBase Tree Display for Variation: WBVar00250573
expand all nodes | collapse all nodes | view schema
WBVar00250573 | Name | Public_name | tm1589 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE28765:p.Asn20ArgfsTer14 | ||||||||
R12E2.5.2:c.58_259del | |||||||||
R12E2.5.1:c.58_259del | |||||||||
HGVSg | CHROMOSOME_I:g.4162114_4162583del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R12E2 | |||||
Flanking_sequences | tatgcgcagacggtcacaagtctgtcggat | cgaatcttccagctgctgaaacaagagaag | |||||||
Mapping_target | R12E2 | ||||||||
Source_location | 7 | CHROMOSOME_I | 4162113 | 4162584 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1589_external | ||||||||
tm1589_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1589 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002138 | |||||||
Transcript | R12E2.5.1 (11) | ||||||||
R12E2.5.2 (11) | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Mapping_data | In_multi_point | 4977 | |||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. H. Sawa to the National Bioresource Project of Japan: slow growth in larval stage. Dr. C.P. Hunter: slow growth at 20C. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | HS | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000032 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson48 | |||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Barmann: Sick. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comments to the National Bioresource Project of Japan: Dr. C. Barmann: Sick | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | HS | ||||||||
Penetrance | Low | rare | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. H. Sawa to the National Bioresource Project of Japan: rare embryonic lethality (2/100). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | HS | ||||||||
Penetrance | Low | rare | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 2 | 2 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000154 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson48 | |||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Barmann: very reduced brood size. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comments to the National Bioresource Project of Japan: Dr. C. Barmann: very reduced brood size. | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | HS | ||||||||
Penetrance | Low | rare | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson48 | |||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Barmann: thin. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Comments to the National Bioresource Project of Japan: Dr. C. Barmann: thin | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | HS | ||||||||
Penetrance | Low | rare | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000659 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Barmann: High locomotion on food. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | rare | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004028 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Barmann: High locomotion on food | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | HS | ||||||||
Reference | WBPaper00065282 | ||||||||
Remark | 14520/14521-14990/14991 (470 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |