WormBase Tree Display for Variation: WBVar00250581

WBVar00250581 Name: Public_name: tm1599
    HGVSg: CHROMOSOME_I:g.7095231_7095983del
  Sequence_details: SMap: S_parent: Sequence: F22D6
    Flanking_sequences: cgtttgactgcagcaaagcgcctttgaggt tatcgcatgggttcagccagaatgcctcgg
    Mapping_target: F22D6
    Source_location: 7 CHROMOSOME_I 7095230 7095984 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1599_external
      tm1599_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1599
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009052
    Transcript: F22D6.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-400
        CDS_position: ?-398
        Protein_position: ?-133
        Intron_number: 2-3/12
        Exon_number: 1-4/13
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 21872/21873-22625/22626 (753 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele