WormBase Tree Display for Variation: WBVar00250583

WBVar00250583 Name: Public_name: tm1601
    HGVSg: CHROMOSOME_I:g.5655462_5655859del
  Sequence_details: SMap: S_parent: Sequence: F55F8
    Flanking_sequences: tggttgatcttggatctcttcatttccttt gaaaatacttgaatgaaaaattgaagaaag
    Mapping_target: F55F8
    Source_location: 7 CHROMOSOME_I 5655461 5655860 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1601_external
      tm1601_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1601
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018892
    Transcript: F55F8.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-349
        CDS_position: ?-312
        Protein_position: ?-104
        Intron_number: 2/5
        Exon_number: 1-3/6
      F55F8.4.2 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-339
        CDS_position: ?-312
        Protein_position: ?-104
        Intron_number: 2/5
        Exon_number: 1-3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. A. Hajnal: Emb. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: AH
      WBPhenotype:0000055 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. A. Puoti: L1-L2 arrest. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: AP
      WBPhenotype:0000059 Paper_evidence: WBPaper00036278
        Curator_confirmed: WBPerson502
        Remark: mostly L1 stage arrest. 10% arrest as early L2. Paper_evidence: WBPaper00036278
            Curator_confirmed: WBPerson502
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. A. Hajnal: Emb. Dr. A. Puoti: L1-L2 arrest. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
              AH
              AP
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Reference: WBPaper00036278
  Remark: 10348/10349-10746/10747 (398 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele