WormBase Tree Display for Variation: WBVar00250597

WBVar00250597 Name: Public_name: tm1618
    HGVSg: CHROMOSOME_I:g.6732064_6733003delinsTTTTCAAAATTTCACTTACC
  Sequence_details: SMap: S_parent: Sequence: W02D3
    Flanking_sequences: tttccttttttcaaaatttcacttaccact aatcaaaattgtgacttttctctgacttta
    Mapping_target: W02D3
    Source_location: 7 CHROMOSOME_I 6732063 6733004 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTTCAAAATTTCACTTACC
      Deletion
    PCR_product: tm1618_external
      tm1618_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1618
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002257
    Transcript: W02D3.7.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-213
        CDS_position: ?-206
        Protein_position: ?-69
        Exon_number: 1-2/4
    Interactor (21)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
    Mapping_data: In_multi_point: 4956
  Description: Phenotype: WBPhenotype:0000134 Paper_evidence: WBPaper00039781
        Curator_confirmed: WBPerson712
        Remark: Of the 19 putative NHR-49 target genes, 14 genes showed a similar expression pattern with different level of alteration in lbp-5(tm1618) and nhr-49(nr2041) mutant worms; however, in general, alterations in gene expression were larger in nhr-49(nr2041) than in lbp-5(tm1618) animals for NHR-49 target genes. Paper_evidence: WBPaper00039781
            Curator_confirmed: WBPerson712
      WBPhenotype:0000154 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Y-K. Paik to the National Bioresource Project of Japan: brood size reduced Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: YP
      WBPhenotype:0000717 Paper_evidence: WBPaper00039781
        Curator_confirmed: WBPerson712
        Remark: Stearic acid-mediated induction of fat-5, fat-6, fat-7, gei-7, and sdha-2, and reduction in elo-2 expression was abolished. Feeding animals other fatty acids also influenced gene expression of other nhr-49 regulated loci. Paper_evidence: WBPaper00039781
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00001708 Paper_evidence: WBPaper00039781
              Curator_confirmed: WBPerson712
      WBPhenotype:0000738 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. M. Herman: life span change by some bacteria. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KS
      WBPhenotype:0001184 Paper_evidence: WBPaper00039781
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited elevated fat storage based on Sudan black staining, further animals exhibited elevated total TG levels. Animals accumulated fat granules in their intestines. Paper_evidence: WBPaper00039781
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000039 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Y-K. Paik to the National Bioresource Project of Japan: normal life span Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: YP
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000138 Paper_evidence: WBPaper00039781
        Curator_confirmed: WBPerson712
        Remark: The relative content in fatty acid increased in animals, as measured by GC-MS, which is comparable to N2 animals. Fatty acids fed and measured: oleic acid, palmitic acid, stearic acid, and PUFA (arachidonic acid and alpha-linolenic acid). Paper_evidence: WBPaper00039781
            Curator_confirmed: WBPerson712
  Reference: WBPaper00039781
  Remark: 12511/12512-TTTTCAAAATTTCACTTACC-13451/13452 (940 bp deletion + 20 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele