WormBase Tree Display for Variation: WBVar00250609
expand all nodes | collapse all nodes | view schema
WBVar00250609 | Name | Public_name | tm1630 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C26E6.9a.1:c.-44_275del | |||||||
HGVSg | CHROMOSOME_III:g.4929747_4930175del | |||||||
Sequence_details | SMap | S_parent | Sequence | C26E6 | ||||
Flanking_sequences | aaggagttggtttgatataccgatgattgt | gcaattttcatccgatgcacagtagaaatc | ||||||
Mapping_target | C26E6 | |||||||
Source_location | 7 | CHROMOSOME_III | 4929746 | 4930176 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1630_external | |||||||
tm1630_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1630 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004782 | ||||||
Transcript | C26E6.9c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-275 | |||||||
CDS_position | ?-275 | |||||||
Protein_position | ?-92 | |||||||
Intron_number | 1-2/16 | |||||||
Exon_number | 1-3/17 | |||||||
C26E6.9a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C26E6.9a.1:c.-44_275del | |||||||
cDNA_position | 30-348 | |||||||
CDS_position | ?-275 | |||||||
Protein_position | ?-92 | |||||||
Intron_number | 2-3/17 | |||||||
Exon_number | 1-4/18 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr.W.G. Kelly to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KW | |||||||
WBPhenotype:0000886 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr.W.G. Kelly to the National Bioresource Project of Japan: WT. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KW | |||||||
Remark | 12135/12136-12564/12565 (429 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |