WormBase Tree Display for Variation: WBVar00250613
expand all nodes | collapse all nodes | view schema
WBVar00250613 | Name | Public_name | tm1634 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H06H21.10b.1:c.324+11_460-26del | |||||||
H06H21.10e.1:c.429+11_565-26del | ||||||||
H06H21.10c.1:c.324+11_460-26del | ||||||||
H06H21.10f.1:c.429+11_565-26del | ||||||||
H06H21.10d.1:c.429+11_565-26del | ||||||||
H06H21.10a.1:c.324+11_460-26del | ||||||||
HGVSg | CHROMOSOME_IV:g.4839634_4840384del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y17G9A | ||||
Flanking_sequences | tcagcctggaatatattgaatagccgaaaa | aaatacttaccgcatcatcgtacccatctt | ||||||
Mapping_target | Y17G9A | |||||||
Source_location | 7 | CHROMOSOME_IV | 4839633 | 4840385 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1634_external | |||||||
tm1634_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1634 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00168098 | ||||||
WBGene00167460 | ||||||||
WBGene00019166 | ||||||||
WBGene00168638 | ||||||||
WBGene00201520 | ||||||||
WBGene00172115 | ||||||||
Transcript (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Mapping_data | In_multi_point | 4954 | ||||||
Description | Phenotype | WBPhenotype:0000209 | Paper_evidence | WBPaper00040902 | ||||
Curator_confirmed | WBPerson6852 | |||||||
Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han; normal growth. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han; fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040902 | |||||||
Remark | 32600/32601-33351/33352 (751 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target H06H21 updated based on the VEP analysis pipeline to Y17G9A. | ||||||||
Method | NBP_knockout_allele |