WormBase Tree Display for Variation: WBVar00250618

WBVar00250618 Name: Public_name: tm1639
    Other_name: W09G12.1.1:c.499+208_500-251del
    HGVSg: CHROMOSOME_IV:g.1203417_1203721del
  Sequence_details: SMap: S_parent: Sequence: W09G12
    Flanking_sequences: cacgaaaactactgtaggtttcgtggtggg accctaatttttcggattcgagaaaaatag
    Mapping_target: W09G12
    Source_location: 7 CHROMOSOME_IV 1203416 1203722 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1639_external
      tm1639_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1639
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001104
    Transcript: W09G12.1.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: W09G12.1.1:c.499+208_500-251del
        Intron_number: 3/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: wt locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 795/796-1100/1101 (305 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele