WormBase Tree Display for Variation: WBVar00250618
expand all nodes | collapse all nodes | view schema
WBVar00250618 | Name | Public_name | tm1639 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | W09G12.1.1:c.499+208_500-251del | |||||||
HGVSg | CHROMOSOME_IV:g.1203417_1203721del | |||||||
Sequence_details | SMap | S_parent | Sequence | W09G12 | ||||
Flanking_sequences | cacgaaaactactgtaggtttcgtggtggg | accctaatttttcggattcgagaaaaatag | ||||||
Mapping_target | W09G12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 1203416 | 1203722 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1639_external | |||||||
tm1639_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1639 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001104 | ||||||
Transcript | W09G12.1.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | W09G12.1.1:c.499+208_500-251del | |||||||
Intron_number | 3/4 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: wt locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 795/796-1100/1101 (305 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |