WormBase Tree Display for Variation: WBVar00250628

WBVar00250628 Name: Public_name: tm1651
    HGVSg: CHROMOSOME_I:g.9419019_9419896del
  Sequence_details: SMap: S_parent: Sequence: C17E4
    Flanking_sequences: ttagtgtgaaatggattttcccgcatttgt agattctattgataagctagctgcacatct
    Mapping_target: C17E4
    Source_location: 7 CHROMOSOME_I 9419018 9419897 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1651_external
      tm1651_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00055841
    Laboratory: FX
      CA
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1651
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007644
    Transcript: C17E4.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-348
        CDS_position: ?-317
        Protein_position: ?-106
        Intron_number: 2-3/4
        Exon_number: 1-4/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00065003
        Curator_confirmed: WBPerson60950
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. I. Mori: could not examine thermotaxis. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Paper_evidence: WBPaper00065003
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
          WBPerson60950
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Reference: WBPaper00065003
    WBPaper00065722
  Remark: 14023/14024-14901/14902 (878 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele