WormBase Tree Display for Variation: WBVar00250664

WBVar00250664 Name: Public_name: tm1692
    Other_name: C46E10.9:n.1138_1649del
    HGVSg: CHROMOSOME_II:g.3727876_3728531del
  Sequence_details: SMap: S_parent: Sequence: C46E10
    Flanking_sequences: ctggagcgtgaagggcattgtgcaacaggc cccattagaaccggtgagagtttggtgcct
    Mapping_target: C46E10
    Source_location: 7 CHROMOSOME_II 3727875 3728532 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1692_external
      tm1692_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031310
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1692
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016712
      WBGene00016713
    Transcript: C46E10.8.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-221
        Exon_number: 1/9
    Pseudogene: C46E10.9 VEP_consequence: splice_acceptor_variant,splice_donor_variant,non_coding_transcript_exon_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C46E10.9:n.1138_1649del
        cDNA_position: 1138-1649
        Intron_number: 4-6/6
        Exon_number: 4-7/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000520 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. L. Mathies: no obvious morphological defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. L. Mathies: locomotion normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. L. Mathies: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 18383/18384-19039/19040 (656 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele