WormBase Tree Display for Variation: WBVar00250697

WBVar00250697 Name: Public_name: tm1730
    Other_name: T14G11.3.1:c.309_733-227del
    HGVSg: CHROMOSOME_X:g.2685977_2686687del
  Sequence_details: SMap: S_parent: Sequence: T14G11
    Flanking_sequences: cacataataacttgtgtagcagttcaaaaa tccttgaggtcaccgatctgttgttttgtc
    Mapping_target: T14G11
    Source_location: 7 CHROMOSOME_X 2685976 2686688 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1730_external
      tm1730_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1730
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020511
    Transcript: T14G11.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T14G11.3.1:c.309_733-227del
        cDNA_position: 336-?
        CDS_position: 309-?
        Protein_position: 103-?
        Intron_number: 5-6/12
        Exon_number: 5-6/13
    Interactor: WBInteraction000501298
      WBInteraction000501299
      WBInteraction000518382
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Gro. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000545 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from H-S. Koo to the National Bioresource Project of Japan: adult worms contain several embryos later than 2-fold stage. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: NB
      WBPhenotype:0001282 Paper_evidence: WBPaper00038057
        Curator_confirmed: WBPerson712
        Remark: There were no statistically significant differences between mitochondrial to nuclear DNA ratios in wild-type (N2) and mutant animals. Paper_evidence: WBPaper00038057
            Curator_confirmed: WBPerson712
      WBPhenotype:0001401 Paper_evidence: WBPaper00038057
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
          WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: H-S. Koo: morphological defects in mitochondria; Dr. A. van der Bliek: Mitochondria are swollen and disorganized in muscle and hypodermal cells. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
          Defects in immt-1 yield mitochondria with localized swellings and thin tubular extensions. Mitochondria are relatively short compared with drp-1 mutants. Mitochondria also exhibit some variability in the degree of connectivity. | Cristae become distended in immt-1(tm1730) mutant animals as observed through EM. Paper_evidence: WBPaper00038057
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0003675 PATO:0000460 Paper_evidence: WBPaper00038057
                Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson557
                  WBPerson712
            WBbt:0007846 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson557
          GO_term: GO:0005739 PATO:0000460 Paper_evidence: WBPaper00038057
                Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000030 Paper_evidence: WBPaper00038057
        Curator_confirmed: WBPerson712
        Remark: Mutation had little or no effect on growth. Paper_evidence: WBPaper00038057
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Paper_evidence: WBPaper00038057
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: normal brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
          Mutation had little or no effect on brood size. Paper_evidence: WBPaper00038057
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000717 Paper_evidence: WBPaper00038057
        Curator_confirmed: WBPerson712
        Remark: Animals were no more sensitive to stress than controls, as suggested by the lack of nuclear localization of DAF-16::GFP (unpublished data), which is a reporter for elevated levels of reactive oxygen species (ROS) in C. elegans. Paper_evidence: WBPaper00038057
            Curator_confirmed: WBPerson712
      WBPhenotype:0001400 Paper_evidence: WBPaper00038057
        Curator_confirmed: WBPerson712
        Remark: MOMA-1 protein levels were not significantly altered in these worms. Paper_evidence: WBPaper00038057
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038057
    WBPaper00065829
  Remark: 7555/7556-8266/8267 (711 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele