WormBase Tree Display for Variation: WBVar00250748

WBVar00250748 Name: Public_name: tm1783
    HGVSg: CHROMOSOME_X:g.4970642_4971110del
  Sequence_details: SMap: S_parent: Sequence: M03F4
    Flanking_sequences: tttgaaggtcatgagactttaaaagaacat gacagcccaaaactacggacagacgcccga
    Mapping_target: M03F4
    Source_location: 7 CHROMOSOME_X 4970641 4971111 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1783_external
      tm1783_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1783
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019760
    Transcript: M03F4.7a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/5
        Exon_number: 1-3/6
      M03F4.7b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-217
        CDS_position: ?-199
        Protein_position: ?-67
        Intron_number: 2/4
        Exon_number: 1-3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype (14)
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Originally classified as lethal or sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. J. Ahnn: homozygous viable. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KJ
              FX
  Reference: WBPaper00035135
    WBPaper00061175
    WBPaper00065201
  Remark: 22677/22678-23146/23147 (469 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: NBP_knockout_allele