WormBase Tree Display for Variation: WBVar00250749

WBVar00250749 Name: Public_name: tm1784
    HGVSg: CHROMOSOME_X:g.2413166_2413650delinsAAGGTT
  Sequence_details: SMap: S_parent: Sequence: C43H6
    Flanking_sequences: gttaccaagttttagaatttgaacctacct tgtaaaaggtttggcaaattgccaaattaa
    Mapping_target: C43H6
    Source_location: 7 CHROMOSOME_X 2413165 2413651 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAGGTT
      Deletion
    PCR_product: tm1784_external
      tm1784_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1784
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001959
    Transcript: C43H6.8.1 VEP_consequence: splice_region_variant,coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: LOW
        cDNA_position: ?-212
        CDS_position: ?-123
        Protein_position: ?-41
        Exon_number: 1-2/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
    Mapping_data: In_multi_point: 5080
  Description: Phenotype: WBPhenotype:0000032 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Ashrafi to the National Bioresource Project of Japan: healthy. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001182 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Ashrafi to the National Bioresource Project of Japan: has altered fat content at L4 and adult stage. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
            WBls:0000038 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Ashrafi to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 17940/17941-AAGGTT-18425/18426 (485 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele