WormBase Tree Display for Variation: WBVar00250785
expand all nodes | collapse all nodes | view schema
WBVar00250785 | Name | Public_name | tm1821 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.6451657_6452587del | |||||||
Sequence_details | SMap | S_parent | Sequence | T26A5 | ||||
Flanking_sequences | tttccatggagattcttttgtcgcatcgat | ggaaaagccatcttggatgtacctgaaaaa | ||||||
Mapping_target | T26A5 | |||||||
Source_location | 7 | CHROMOSOME_III | 6451656 | 6452588 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1821_external | |||||||
tm1821_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1821 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004781 | ||||||
Transcript | T26A5.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-543 | |||||||
CDS_position | ?-102 | |||||||
Protein_position | ?-34 | |||||||
Intron_number | 1-2/5 | |||||||
Exon_number | 1-4/6 | |||||||
T26A5.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-529 | |||||||
CDS_position | ?-513 | |||||||
Protein_position | ?-171 | |||||||
Intron_number | 2-3/5 | |||||||
Exon_number | 1-4/6 | |||||||
T26A5.7b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-359 | |||||||
CDS_position | ?-102 | |||||||
Protein_position | ?-34 | |||||||
Intron_number | 1/4 | |||||||
Exon_number | 1-3/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr.R. H. Horvitz: not synMuv with class A or B mutations and not a synMuv suppressor. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
MT | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. R.H. Horvitz: recessive sterile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
MT | ||||||||
Recessive | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00048953 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "H4K20me1 reduction due to set-1 or dpy-21 null mutation led to a significant increase in X chromosome expression compared to autosomes in L3 larvae (Fig 5C). We observed a small but significant increase in X expression compared to autosomes in the set-4(n4600) mutant L3 (Fig 5C) and mixed stage embryos (Fig 5D). Expression of previously defined dosage compensated genes [11,23,42] were increased in dpy-21(e428), set-1(tm1821), but not as much in set-4 (n4600) mutant (Fig 5E). To test if a subset of X chromosomal genes were responsible for the effect seen in the set-4(n4600) mutant (Fig 5C), we plotted the distribution of expression ratios on the X and autosomes (Fig 5F). This indicated a slight shift between X and autosomes, suggesting that set-4(n4600) has a subtle effect across all genes, rather than a large effect on a subset of X chromosomal genes." | Paper_evidence | WBPaper00048953 | |||||
Curator_confirmed | WBPerson2987 | |||||||
"To understand the role of dpy-21 in the DCC, we compared gene expression changes in dpy-27 RNAi, dpy-21(e428), set-1(tm1821) and set-4(n4600) mutant L3 larvae by clustering differential expression ratios on the X chromosome and autosomes (Fig 6A). We note that while the effect of dpy-27 RNAi and dpy-21(e428) were generally similar on the X, genes in several clusters were affected differently between dpy-27 RNAi and dpy-21 (e428). We performed gene ontology (GO) analyses comparing enriched functions in each cluster compared to the whole genome (Fig 6B). Interestingly, the effect of dpy-27 RNAi and dpy-21(e428) on clusters enriched for cuticle genes were opposite, yet both mutations result in a dumpy phenotype." | Paper_evidence | WBPaper00048953 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001348 | Paper_evidence | WBPaper00046016 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Decreased X chromosome compaction leading to enlarged X chromosomes. | Paper_evidence | WBPaper00046016 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001361 | Paper_evidence | WBPaper00046016 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Decreased X chromosome compaction leading to enlarged X chromosomes. | Paper_evidence | WBPaper00046016 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001504 | Paper_evidence | WBPaper00048953 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We analyzed genome-wide expression changes that occur in dpy-21(e428), set-1(tm1821) and set-4(n4600) null mutants [18,19]. Set-1 null mutant is maternal effect sterile, and RNAi knockdown of set-1 leads to germline deficient adults, thus we could not isolate embryos. Therefore, we collected set-1(tm1821) homozygous and heterozygous L3 larvae (see Material and Methods). Western blot analysis in whole-larval extracts showed expected changes in H4K20me1 (Fig 5B) [18,19]. H4K20me1 reduced in dpy-21(e428), increased in set-4(n4600), and was eliminated in set-1(tm1821)." | Paper_evidence | WBPaper00048953 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00048953 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We analyzed genome-wide expression changes that occur in dpy-21(e428), set-1(tm1821) and set-4(n4600) null mutants [18,19]. Set-1 null mutant is maternal effect sterile, and RNAi knockdown of set-1 leads to germline deficient adults, thus we could not isolate embryos. Therefore, we collected set-1(tm1821) homozygous and heterozygous L3 larvae (see Material and Methods). Western blot analysis in whole-larval extracts showed expected changes in H4K20me1 (Fig 5B) [18,19]. H4K20me1 reduced in dpy-21(e428), increased in set-4(n4600), and was eliminated in set-1(tm1821)." | Paper_evidence | WBPaper00048953 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00048953 | |||||||
WBPaper00046016 | ||||||||
Remark | 3813/3814-4744/4745 (931 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |