WormBase Tree Display for Variation: WBVar00250788
expand all nodes | collapse all nodes | view schema
WBVar00250788 | Name | Public_name | tm1824 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.2413048_2413910del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C43H6 | |||||
Flanking_sequences | agaatttcaatttttgaaagtttcttttca | ctggcgctacttcacatttaaaaacttaaa | |||||||
Mapping_target | C43H6 | ||||||||
Source_location | 7 | CHROMOSOME_X | 2413047 | 2413911 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1824_external | ||||||||
tm1824_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1824 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001959 | |||||||
WBGene00001618 | |||||||||
Transcript | C43H6.9a.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 2263-? | ||||||||
Exon_number | 14/14 | ||||||||
C43H6.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-280 | ||||||||
CDS_position | ?-191 | ||||||||
Protein_position | ?-64 | ||||||||
Intron_number | 2/3 | ||||||||
Exon_number | 1-3/4 | ||||||||
C43H6.9a.2 | VEP_consequence | 3_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 2409-? | ||||||||
Exon_number | 17/17 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0001182 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. K. Ashrafi to the National Bioresource Project of Japan: has altered fat content at L4 and adult stage. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001434 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project from Dr. T. Ishihara: normal chemotaxis to diacetyl, isoamylalcohol and benzaldehyde. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002819 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00001063 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00002087 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. K. Ashrafi to the National Bioresource Project of Japan: healthy. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. K. Ashrafi to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001510 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. O. Hobert: ASE and AIY fate markers normal. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 17822/17823-18685/18686 (863 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |