WormBase Tree Display for Variation: WBVar00250790

WBVar00250790 Name: Public_name: tm1826
    Other_name: F56D2.7.1:c.155-22_478delinsCGA
    HGVSg: CHROMOSOME_III:g.5596248_5596751delinsCGA
  Sequence_details: SMap: S_parent: Sequence: F56D2
    Flanking_sequences: ttgaacattaaaaaatcttcattcgacaat ggaagccgtcttgttacgcgttcacatcag
    Mapping_target: F56D2
    Source_location: 7 CHROMOSOME_III 5596247 5596752 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CGA
      Deletion
    PCR_product: tm1826_external
      tm1826_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1826
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000420
    Transcript: F56D2.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F56D2.7.1:c.155-22_478delinsCGA
        cDNA_position: ?-478
        CDS_position: ?-478
        Protein_position: ?-160
        Intron_number: 1-2/5
        Exon_number: 2-3/6
    Interactor: WBInteraction000517315
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000885 Paper_evidence: WBPaper00038317
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Hengartner to the National Bioresource Project of Japan: defective in engulfment of apoptotic cells. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: WS
          Persistent cell corpses accumulate. Paper_evidence: WBPaper00038317
            Curator_confirmed: WBPerson712
      WBPhenotype:0001180 Paper_evidence: WBPaper00044144
        Curator_confirmed: WBPerson2987
        Remark: ced-6(tm1826) mutants exhibited an accumulation of germ cell corpses compared to controls, as determined by DIC microscopy (Figure 1c) Paper_evidence: WBPaper00044144
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001181 Paper_evidence: WBPaper00044144
        Curator_confirmed: WBPerson2987
        Remark: ced-6(tm1826) mutants exhibited an accumulation of somatic cell corpses in the head of L1 larvae compared to controls, as determined by DIC microscopy (Figure 1d) Paper_evidence: WBPaper00044144
            Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000679 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Matsumoto to the National Bioresource Project of Japan: localization of APL-1::GFP protein was not altered. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KU
  Reference: WBPaper00038317
    WBPaper00044144
  Remark: 17698/17699-CGA-18202/18203 (504 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele