WormBase Tree Display for Variation: WBVar00250797
expand all nodes | collapse all nodes | view schema
WBVar00250797 | Name | Public_name | tm1833 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_V:g.12271818_12272675delinsGGCA | |||||||
Sequence_details | SMap | S_parent | Sequence | F55C5 | ||||
Flanking_sequences | ttatttttaggtgaaaactttaatactatt | aatcagcgaattctggcttcttattccaaa | ||||||
Mapping_target | F55C5 | |||||||
Source_location | 7 | CHROMOSOME_V | 12271817 | 12272676 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | GGCA | ||||||
Deletion | ||||||||
PCR_product | tm1833_external | |||||||
tm1833_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023524 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1833 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010093 | ||||||
Transcript | F55C5.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-757 | |||||||
CDS_position | ?-746 | |||||||
Protein_position | ?-249 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-3/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000032 | Paper_evidence | WBPaper00032450 | ||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Sck | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Mutants are sick (data not shown). | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. B.J. Meyer: Let. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000230 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants have withered tails (data not shown). | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032450 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: maternal effect Unc | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Mutants become uncoordinated (data not shown). | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00032450 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Ste | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Mutants become sterile adults (data not shown). | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00032450 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Pvl | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Mutants display protruding vulvae (data not shown). | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The germline was extremely underproliferated and contained only a small patch of abnormal nuclei. | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000900 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: abnormal staining in the germ cells | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001378 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032450 | |||||||
Remark | 9703/9704-GGCA-10561/10562 (858 bp deletion + 4 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |