WormBase Tree Display for Variation: WBVar00250797

WBVar00250797 Name: Public_name: tm1833
    HGVSg: CHROMOSOME_V:g.12271818_12272675delinsGGCA
  Sequence_details: SMap: S_parent: Sequence: F55C5
    Flanking_sequences: ttatttttaggtgaaaactttaatactatt aatcagcgaattctggcttcttattccaaa
    Mapping_target: F55C5
    Source_location: 7 CHROMOSOME_V 12271817 12272676 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GGCA
      Deletion
    PCR_product: tm1833_external
      tm1833_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00023524
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1833
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010093
    Transcript: F55C5.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-757
        CDS_position: ?-746
        Protein_position: ?-249
        Intron_number: 2/7
        Exon_number: 1-3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000032 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Sck Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants are sick (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. B.J. Meyer: Let. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000230 Paper_evidence: WBPaper00032450
        Curator_confirmed: WBPerson712
        Remark: Mutants have withered tails (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: maternal effect Unc Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants become uncoordinated (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
          Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
        Maternal
      WBPhenotype:0000688 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Ste Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants become sterile adults (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000697 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Pvl Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants display protruding vulvae (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000823 Paper_evidence: WBPaper00032450
        Curator_confirmed: WBPerson712
        Remark: The germline was extremely underproliferated and contained only a small patch of abnormal nuclei. Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000900 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: abnormal staining in the germ cells Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001378 Paper_evidence: WBPaper00032450
        Curator_confirmed: WBPerson712
        Remark: Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
  Reference: WBPaper00032450
  Remark: 9703/9704-GGCA-10561/10562 (858 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele