WormBase Tree Display for Variation: WBVar00250801

WBVar00250801 Name: Public_name: tm1837
    Other_name: F44C8.2.1:c.239-184_664-113delinsGTTTT
    HGVSg: CHROMOSOME_V:g.2231848_2232626delinsGTTTT
  Sequence_details: SMap: S_parent: Sequence: F44C8
    Flanking_sequences: taaaacaactttttagaaatttttctagga tttagtgagcaacacaacgcgggcctcgat
    Mapping_target: F44C8
    Source_location: 7 CHROMOSOME_V 2231847 2232627 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GTTTT
      Deletion
    PCR_product: tm1837_external
      tm1837_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1837
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003724
    Transcript: F44C8.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F44C8.2.1:c.239-184_664-113delinsGTTTT
        Intron_number: 4-6/8
        Exon_number: 5-6/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
    Mapping_data: In_multi_point: 5202
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 21790/21791-GTTTT-22569/22570 (779 bp deletion + 5 bp insertion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele