WormBase Tree Display for Variation: WBVar00250823
expand all nodes | collapse all nodes | view schema
WBVar00250823 | Name | Public_name | tm1860 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | R09A1.1a.1:c.1126+448_1391del | ||||||||
HGVSg | CHROMOSOME_V:g.1011227_1012384del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R09A1 | |||||
Flanking_sequences | tattatatgaacacaaaattctgagaatgc | acggaatttcaagtttgtcgggctcggagc | |||||||
Mapping_target | R09A1 | ||||||||
Source_location | 7 | CHROMOSOME_V | 1011226 | 1012385 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1860_external | ||||||||
tm1860_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040450 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1860 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00019971 | |||||||
Transcript | R09A1.1b.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-170 | ||||||||
CDS_position | ?-170 | ||||||||
Protein_position | ?-57 | ||||||||
Exon_number | 1/5 | ||||||||
R09A1.1a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R09A1.1a.1:c.1126+448_1391del | ||||||||
cDNA_position | ?-1401 | ||||||||
CDS_position | ?-1391 | ||||||||
Protein_position | ?-464 | ||||||||
Intron_number | 3/8 | ||||||||
Exon_number | 4/9 | ||||||||
Interactor | WBInteraction000521281 | ||||||||
WBInteraction000521418 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00035324 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Only targets of class II oocyte/embryo 26G RNAs were upregulated in the ergo-1(tm1860) mutant | Paper_evidence | WBPaper00035324 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00044603 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | transgene expression was silenced; wild-type animals express the transgene | Paper_evidence | WBPaper00044603 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mgIs30 | Paper_evidence | WBPaper00044603 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001776 | Paper_evidence | WBPaper00035324 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ergo-1 is required for the expression of class II oocyte/embryo 26G RNAs | Paper_evidence | WBPaper00035324 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00049012 | ||||||
Curator_confirmed | WBPerson11446 | ||||||||
Remark | these mutant worms all have normal life spans | Paper_evidence | WBPaper00049012 | ||||||
Curator_confirmed | WBPerson11446 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00031962 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of 21U-RNA, from Nothern blot or from qRT-PRC, were comparable to that of wild-type. | Paper_evidence | WBPaper00031962 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034585 | PATO:0000460 | Paper_evidence | WBPaper00031962 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031962 | ||||||||
WBPaper00035324 | |||||||||
WBPaper00044603 | |||||||||
WBPaper00049012 | |||||||||
Remark | 7750/7751-8908/8909 (1158 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |