WormBase Tree Display for Variation: WBVar00250831

WBVar00250831 Name: Public_name: tm1868
    Other_name: F35G12.8.1:c.216+10_995del
    HGVSg: CHROMOSOME_III:g.4587784_4588686del
  Sequence_details: SMap: S_parent: Sequence: F35G12
    Flanking_sequences: gacagtgatcttttctcattggtatgttac acggtagttctgaaatattccaggttaaaa
    Mapping_target: F35G12
    Source_location: 7 CHROMOSOME_III 4587783 4588687 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1868_external
      tm1868_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00023523
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1868
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004874
    Transcript: F35G12.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F35G12.8.1:c.216+10_995del
        cDNA_position: ?-1000
        CDS_position: ?-995
        Protein_position: ?-332
        Intron_number: 3-5/16
        Exon_number: 4-6/17
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
    Mapping_data: In_multi_point: 5151
  Description: Phenotype: WBPhenotype:0000032 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Sck Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants are sick (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. B.J. Meyer: Let. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000230 Paper_evidence: WBPaper00032450
        Curator_confirmed: WBPerson712
        Remark: Mutants have withered tails (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: maternal effect Unc Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants become uncoordinated (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
          Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
        Maternal
      WBPhenotype:0000688 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Dr. K. Hagstrom: Ste Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants become sterile adults (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000697 Paper_evidence: WBPaper00032450
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: Pvl Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          Mutants display protruding vulvae (data not shown). Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000823 Paper_evidence: WBPaper00032450
        Curator_confirmed: WBPerson712
        Remark: The germline was extremely underproliferated and contained only a small patch of abnormal nuclei. Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
      WBPhenotype:0000900 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Hagstrom: abnormal staining in the germ cells. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001378 Paper_evidence: WBPaper00032450
        Curator_confirmed: WBPerson712
        Remark: Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. Paper_evidence: WBPaper00032450
            Curator_confirmed: WBPerson712
  Reference: WBPaper00032450
  Remark: 21576/21577-22479/22480 (903 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele