WormBase Tree Display for Variation: WBVar00250832
expand all nodes | collapse all nodes | view schema
WBVar00250832 | Name | Public_name | tm1869 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F27D9.8.1:c.374-45_656del | |||||||
HGVSg | CHROMOSOME_X:g.7678188_7678998del | |||||||
Sequence_details | SMap | S_parent | Sequence | F27D9 | ||||
Flanking_sequences | aacctgatattgtcggttccccagaggtat | tagacttgtaccatcatgcccttgcttgat | ||||||
Mapping_target | F27D9 | |||||||
Source_location | 7 | CHROMOSOME_X | 7678187 | 7678999 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1869 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00017866 | ||||||
Transcript | F27D9.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F27D9.8.1:c.374-45_656del | |||||||
cDNA_position | ?-751 | |||||||
CDS_position | ?-656 | |||||||
Protein_position | ?-219 | |||||||
Intron_number | 6-8/16 | |||||||
Exon_number | 7-9/17 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Mapping_data | In_multi_point | 5316 | ||||||
Description | Phenotype | WBPhenotype:0000324 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. Lihsia Chen: short. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001265 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. Lihsia Chen: hyperactive head bending. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Disease_info | Models_disease | DOID:11723 | ||||||
Models_disease_in_annotation | WBDOannot00000295 | |||||||
Remark | 28260/28261-29071/29072 (811 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |