WormBase Tree Display for Variation: WBVar00250838

WBVar00250838 Name: Public_name: tm1875
    HGVSg: CHROMOSOME_III:g.10027448_10028729delinsACGGAG
  Sequence_details: SMap: S_parent: Sequence: M04D8
    Flanking_sequences: gattgtgtttcattttgtgacggagccctg aaacacacctgttattgcacattctttaga
    Mapping_target: M04D8
    Source_location: 7 CHROMOSOME_III 10027446 10028731 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GACGGAGC
      Deletion
    PCR_product: tm1875_external
      tm1875_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1875
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002106
    Transcript: M04D8.3.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2/3
        Exon_number: 1-4/4
    Interactor: WBInteraction000543183
      WBInteraction000543204
      WBInteraction000543235
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
    Mapping_data: In_multi_point: 5300
  Description: Phenotype: WBPhenotype:0000131 Paper_evidence: WBPaper00053546
        Curator_confirmed: WBPerson1147
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal morphology. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CF
      WBPhenotype:0000540 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. P. Roy: normal muscle arm development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000637 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan from Dr. M. Driscoll: normal dauer formation; Dr. J. Hubbard: no dauer formation at 20; 25 C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000639 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. C. Kenyon : does not form dauer at 25 C; Dr. J. Hubbard: no dauer formation at 20 & 25 C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng: normal egg-laying. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal fertility. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CF
      WBPhenotype:0001184 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K. Ashrafi: slightly increased Nile Red staining. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00053546
  Remark: 10323/10324-GACGGAGC-11607/11608 (1284 bp deletion + 8 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele