WormBase Tree Display for Variation: WBVar00250852

WBVar00250852 Name: Public_name: tm1889
    Other_name: CE27001:p.Leu124ThrfsTer59
      Y48G1A.5a.1:c.369_826delinsC
    HGVSg: CHROMOSOME_I:g.322082_322935delinsG
  Sequence_details: SMap: S_parent: Sequence: Y48G1A
    Flanking_sequences: cgggcacgaactcggagatctcctcctcgt tctggccatttttcgggaaaatctctctga
    Mapping_target: Y48G1A
    Source_location: 7 CHROMOSOME_I 322081 322936 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm1889_external
      tm1889_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1889
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002079
    Transcript: Y48G1A.5a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 7671/7672-G-8525/8526 (854 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele