WormBase Tree Display for Variation: WBVar00250857

WBVar00250857 Name: Public_name: tm1894
    Other_name: CE45184:p.Thr172MetfsTer3
      ZC449.6.1:c.515_924del
    HGVSg: CHROMOSOME_X:g.5010159_5011066del
  Sequence_details: SMap: S_parent: Sequence: ZC449
    Flanking_sequences: AAGCTGAAGCGTTTGTGCGGTCTCAGTCTA TGCTATAAAATTTTTAACTCAAGCCCACCG
    Mapping_target: ZC449
    Type_of_mutation: Deletion
    PCR_product: tm1894_external
      tm1894_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1894
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022616
    Transcript: ZC449.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 4761/4762-5669/5670 (908 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele