WormBase Tree Display for Variation: WBVar00250859
expand all nodes | collapse all nodes | view schema
WBVar00250859 | Name | Public_name | tm1896 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | T16H5.1a.2:c.440-167_694del | ||||||||
T16H5.1a.1:c.440-167_694del | |||||||||
T16H5.1b.1:c.392-167_646del | |||||||||
HGVSg | CHROMOSOME_I:g.2454714_2455259del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T16H5 | |||||
Flanking_sequences | tacttttgaggcacgcattgagtatcaaaa | ctcggaaattcgaatccgcggaatacaaaa | |||||||
Mapping_target | T16H5 | ||||||||
Source_location | 7 | CHROMOSOME_I | 2454713 | 2455260 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1896_external | ||||||||
tm1896_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1896 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002141 | |||||||
Transcript | T16H5.1a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T16H5.1a.2:c.440-167_694del | ||||||||
cDNA_position | ?-860 | ||||||||
CDS_position | ?-694 | ||||||||
Protein_position | ?-232 | ||||||||
Intron_number | 4-5/8 | ||||||||
Exon_number | 5-6/9 | ||||||||
T16H5.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T16H5.1a.1:c.440-167_694del | ||||||||
cDNA_position | ?-781 | ||||||||
CDS_position | ?-694 | ||||||||
Protein_position | ?-232 | ||||||||
Intron_number | 3-4/7 | ||||||||
Exon_number | 4-5/8 | ||||||||
T16H5.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T16H5.1b.1:c.392-167_646del | ||||||||
cDNA_position | ?-667 | ||||||||
CDS_position | ?-646 | ||||||||
Protein_position | ?-216 | ||||||||
Intron_number | 2-3/6 | ||||||||
Exon_number | 3-4/7 | ||||||||
Interactor | WBInteraction000052098 | ||||||||
WBInteraction000052099 | |||||||||
WBInteraction000052105 | |||||||||
WBInteraction000052106 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Mapping_data | In_multi_point | 5249 | |||||||
Description | Phenotype | WBPhenotype:0000050 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Sawa to the National Bioresource Project of Japan: Some die in embryonic stage (10/100). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 10 | 10 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00029404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not express str-2::GFP in either AWC cell, e.g. both AWC neurons are AWC off (n=142). Only rescued by nsy-5 transgenes expressed in AWC. | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005832 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005833 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000002 | PATO:0000460 | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | str-2::GFP | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: viable | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00029404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | NSY-4::GFP expression was unaltered (data not shown). | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | NSY-4::GFP | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00029404 | ||||||||
WBPaper00065804 | |||||||||
Remark | 2908/2909-3454/3455 (546 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |